Es measured in one system do not directly translate into consistent
Es measured in one system do not directly AN 3199 site translate into consistent...
These results suggest that UBASH3B controls the timing and fidelity of chromosome segregation
spliceostatin A, which inhibits the SF3b subunit of the U2 snRNP, thereby modulating the...
Entage of cells incorporating BrdU after a 2 h pulse was calculated.
Entage of cells incorporating BrdU after a 2 h pulse was calculated. Scale bar...
Cals are ideal neuroprotective agents. Heat shock protein 27 (HSP27) provides robust
Cals are ideal neuroprotective agents. Heat shock protein 27 (HSP27) provides robust cellular protection,...
Ehavior in TD animals and that TD alone is not attributable
Ehavior in TD animals and that TD alone is not attributable to the onset...
Description. It was recently demonstrated [26,27] that the one-dimensional free energy associated
Description. It was recently demonstrated that the one-dimensional free energy associated with the...
Fragment that contains the cdN protein coding sequence, PCR reactions using
Fragment that contains the cdN protein coding sequence, PCR reactions using primers (59CGGAATTCATGGCGCGGAGCGTGCGC 39and...
N the normal controls in WT mice (P,0.05) and CB1??mice
N the normal controls in WT mice (P,0.05) and CB1??mice (P,0.01). TNF-a level remained...
Tics and CIN risk groups. (a) TC classification vs CIN risk
Tics and CIN risk groups. (a) TC classification vs CIN risk groups for UAMSChromosome...
We next focused on the role of Rab21 as part of a potential phagocytic regulatory complex
h is capable of dispersing cells from established biofilms, is one of the most...