Cals are ideal neuroprotective agents. Heat shock protein 27 (HSP27) provides robust
Cals are ideal neuroprotective agents. Heat shock protein 27 (HSP27) provides robust cellular protection,...
Ehavior in TD animals and that TD alone is not attributable
Ehavior in TD animals and that TD alone is not attributable to the onset...
Description. It was recently demonstrated [26,27] that the one-dimensional free energy associated
Description. It was recently demonstrated that the one-dimensional free energy associated with the...
Fragment that contains the cdN protein coding sequence, PCR reactions using
Fragment that contains the cdN protein coding sequence, PCR reactions using primers (59CGGAATTCATGGCGCGGAGCGTGCGC 39and...
N the normal controls in WT mice (P,0.05) and CB1??mice
N the normal controls in WT mice (P,0.05) and CB1??mice (P,0.01). TNF-a level remained...
Tics and CIN risk groups. (a) TC classification vs CIN risk
Tics and CIN risk groups. (a) TC classification vs CIN risk groups for UAMSChromosome...
We next focused on the role of Rab21 as part of a potential phagocytic regulatory complex
h is capable of dispersing cells from established biofilms, is one of the most...
Little, however, has been published on the function of Rab21 in any system
harvested and assayed for cytokines by ELISA analysis. The cultured cells were analyzed for...
On of GLUT1, GLUT12, sweet1 and amino acid transporter gene expression
On of GLUT1, GLUT12, sweet1 and amino acid transporter gene expression by RT-qPCRThe mRNA...
Control cells. As expected, TG significantly increased apoptosis in both control
Control cells. As expected, TG significantly increased apoptosis in both control or TCTP-siRNA treated...