K Gel Extraction Kit (Qiagen Inc) and sequenced with the ABI 3100 DNA Sequencer.Ka/Ks and Conditional selection ratio calculationThe Ka/Ks values for particular amino acid substitutions have been determined as described by Chen et al [10]. To measure how a precise amino acid of one particular web page X influences one within the other website Y. The `conditional choice ratio’ is defined as the ratio of Ka/Ks of Ka Y when the amino acid is mutated at X (( ) divided by the ) Ks Y =Xa Ka ), and Ka/Ks of Y within the absence of any mutation at X (( ) Ks Y =Xo it was computed as follows: Ka NYaXa ) ( Ka Ks Y =Xa NYsXa ( ) Ka NYaXo Ks Y =X ) ( Ks Y =Xo NYsXo Where NYaXa will be the quantity of samples using the exact same amino acid mutation each at internet site Y and X; and NYsXa may be the variety of samples having a synonymous mutation at codon Y and an amino acid mutation at codon X. NYaXo and NYsXo would be the number of samples together with the amino acid mutation in addition to a synonymousCritical Web-sites of NNRTI-Resistance in HIV-1 CRF_BCmutation at codon Y in the absence of any mutation at X respectively. The LOD score by which we evaluated the significance of apparent amino acid pairs was calculated using the following formula: Ka LOD {log10 p(i�NYaXa jN,q, 1) Ks Y jXa ! N X N qi (1{q)N{i {log10 i i NYaXa Where N = NYaXa+NYsXa and q as defined above. If LOD.2, the positive selection is significant.some mutations in the connection domain, such situation should be ruled out because pNL4-3 was wild type reference strain without such mutations.Phenotypic assay to HIV-1 NNRTIs based on TZM-bl cellsHIV-1 (HIV-1WT) and HIV-1 with the mutations (HIV-1MT) were generated by transfection of the plasmids into 293T/17 cells by using Fugene 6 Transfection Reagent (Roche Applied Science) according to the manufacturer’s instructions.RI-1 The 50 tissue culture infectious dose (TCID50) and the antiviral activity of NNRTIs were determined using TZM-b1 cells as previously described [12,13].Chymotrypsin The concentration of drug that effects 50 viral replication (EC50) values was determined by nonlinear regression using GraphPad Prism 5.PMID:35991869 01. Mean EC50 were calculated using all replicates for each virus and are expressed as mean 6 SD. The Wilcoxon rank sum test was applied to pairwise comparisons to determine whether the observed differences between EC50 for different site-mutations were statistically significant.Construction of new pNL4-3 containing HIV-1 CRF_BC pol gene with site-directed mutagenesisThe infectious molecular clone was constructed by incorporating amplified PR and RT regions of CRF_BC into pNL4-3 using BstE II and Age I restriction sites after BstE II at position 2049 (RT region) of pNL4-3 was created by replacing A with T. HIV-1 CRF_BC (CBJB257), which was isolated from treatment-naive intravenous drug user in Xinjiang, China [11], was chosen for viral DNA extraction by a QIAamp Viral DNA Mini Kit (Qiagen Inc., Chatsworth, CA). The extracted viral DNA was used as the template for first-round PCR as previously described [9]. The firstround PCR product and primers (GGAAGGTCACCAAATGAAAGATTGTACTGAGAG and TGTACCGGTTCTTTTAG AATCTCCCTGTTTTCTGCC) were used for secondround PCR, which underlined sequences mark the relevant restriction sites. The nested PCR product was purified using a QIAquick Gel Extraction Kit (Qiagen Inc), digested with BstE II and AgeI (NEB) and then ligated to BstE II – and AgeI-digested pNL4-3. The mutations were introduced into CBJB257 RT regions inserted in T-vector by using site-directed mutagenesis with DNA.
