Fragment that contains the cdN protein coding sequence, PCR reactions using
Fragment that contains the cdN protein coding sequence, PCR reactions using primers (59CGGAATTCATGGCGCGGAGCGTGCGC 39and...
N the normal controls in WT mice (P,0.05) and CB1??mice
N the normal controls in WT mice (P,0.05) and CB1??mice (P,0.01). TNF-a level remained...
Tics and CIN risk groups. (a) TC classification vs CIN risk
Tics and CIN risk groups. (a) TC classification vs CIN risk groups for UAMSChromosome...
We next focused on the role of Rab21 as part of a potential phagocytic regulatory complex
h is capable of dispersing cells from established biofilms, is one of the most...
Little, however, has been published on the function of Rab21 in any system
harvested and assayed for cytokines by ELISA analysis. The cultured cells were analyzed for...
On of GLUT1, GLUT12, sweet1 and amino acid transporter gene expression
On of GLUT1, GLUT12, sweet1 and amino acid transporter gene expression by RT-qPCRThe mRNA...
Control cells. As expected, TG significantly increased apoptosis in both control
Control cells. As expected, TG significantly increased apoptosis in both control or TCTP-siRNA treated...
F European and North American strains [22]. So far, the production of
F European and North American strains . So far, the production of superantigens could...
Yden chamber is likely caused by the fact that (i) Boyden
Yden chamber is likely caused by the fact that (i) Boyden chambers do not...
Solated from mouse eyes following previously published methods [33]. In brief, after
Solated from mouse eyes following previously published methods . In brief, after induction of...